CCDC115, Polyclonal Antibody

CCDC115, Polyclonal Antibody 

Order now: dominika@ksiazkiwnauce.pl

CCDC115 siRNA
20-abx910488	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CCDC115
YF-PA21383	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to CCDC115

anti-CCDC115
YF-PA21384	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CCDC115

anti-CCDC115
YF-PA26724	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to CCDC115

CCDC115 cloning plasmid
CSB-CL853473HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 399 Sequence: atgggcgccaagtcggtagggcccctgcagtatgcttcccacatggagccccaggtctgcctccacgccagcgaggcccaggagggactccagaagttcaaggtggtgagagctggtgtccacgccccagaggaggtggggcctcgcgaagcaggtctgcggaggcgcaagggccc Show more
Description: A cloning plasmid for the CCDC115 gene.

Anti-CCDC115 (4E9)
YF-MA19542	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CCDC115

Human CCDC115 ELISA KIT
ELI-10908h	Lifescience Market	96 Tests	EUR 824

Mouse Ccdc115 ELISA KIT
ELI-11241m	Lifescience Market	96 Tests	EUR 865

Bovine CCDC115 ELISA KIT
ELI-25538b	Lifescience Market	96 Tests	EUR 928

CCDC115 ELISA KIT|Human
EF008436	Lifescience Market	96 Tests	EUR 689

Mouse CCDC115 shRNA Plasmid
20-abx977011	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CCDC115 shRNA Plasmid
20-abx963438	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CCDC115 Recombinant Protein (Human)
RP005839	ABM	100 ug	Ask for price

CCDC115 Recombinant Protein (Rat)
RP193373	ABM	100 ug	Ask for price

CCDC115 Recombinant Protein (Mouse)
RP121547	ABM	100 ug	Ask for price

Coiled-Coil Domain Containing 115 (CCDC115) Antibody
20-abx111723	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Coiled-Coil Domain Containing 115 (CCDC115) Antibody
abx231345-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ccdc115 ORF Vector (Rat) (pORF)
ORF064459	ABM	1.0 ug DNA	EUR 506

CCDC115 ORF Vector (Human) (pORF)
ORF001947	ABM	1.0 ug DNA	EUR 95

Ccdc115 ORF Vector (Mouse) (pORF)
ORF040517	ABM	1.0 ug DNA	EUR 506

CCDC115 sgRNA CRISPR Lentivector set (Human)
K0383901	ABM	3 x 1.0 ug	EUR 339

Ccdc115 sgRNA CRISPR Lentivector set (Rat)
K6315801	ABM	3 x 1.0 ug	EUR 339

Ccdc115 sgRNA CRISPR Lentivector set (Mouse)
K3358501	ABM	3 x 1.0 ug	EUR 339

CCDC115 sgRNA CRISPR Lentivector (Human) (Target 1)
K0383902	ABM	1.0 ug DNA	EUR 154

CCDC115 sgRNA CRISPR Lentivector (Human) (Target 2)
K0383903	ABM	1.0 ug DNA	EUR 154

CCDC115 sgRNA CRISPR Lentivector (Human) (Target 3)
K0383904	ABM	1.0 ug DNA	EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6315802	ABM	1.0 ug DNA	EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6315803	ABM	1.0 ug DNA	EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6315804	ABM	1.0 ug DNA	EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3358502	ABM	1.0 ug DNA	EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3358503	ABM	1.0 ug DNA	EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3358504	ABM	1.0 ug DNA	EUR 154

CCDC115 Protein Vector (Mouse) (pPB-C-His)
PV162066	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Mouse) (pPB-N-His)
PV162067	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Mouse) (pPM-C-HA)
PV162068	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Mouse) (pPM-C-His)
PV162069	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Rat) (pPB-C-His)
PV257834	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Rat) (pPB-N-His)
PV257835	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Rat) (pPM-C-HA)
PV257836	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Rat) (pPM-C-His)
PV257837	ABM	500 ng	EUR 603

CCDC115 Protein Vector (Human) (pPB-C-His)
PV007785	ABM	500 ng	EUR 329

CCDC115 Protein Vector (Human) (pPB-N-His)
PV007786	ABM	500 ng	EUR 329

CCDC115 Protein Vector (Human) (pPM-C-HA)
PV007787	ABM	500 ng	EUR 329

CCDC115 Protein Vector (Human) (pPM-C-His)
PV007788	ABM	500 ng	EUR 329

Ccdc115 3'UTR GFP Stable Cell Line
TU153233	ABM	1.0 ml	Ask for price

Ccdc115 3'UTR Luciferase Stable Cell Line
TU103233	ABM	1.0 ml	Ask for price

Ccdc115 3'UTR Luciferase Stable Cell Line
TU201750	ABM	1.0 ml	Ask for price

Ccdc115 3'UTR GFP Stable Cell Line
TU251750	ABM	1.0 ml	Ask for price

CCDC115 3'UTR GFP Stable Cell Line
TU053697	ABM	1.0 ml	EUR 1394

CCDC115 3'UTR Luciferase Stable Cell Line
TU003697	ABM	1.0 ml	EUR 1394

Goat Coiled coil domain containing protein 115(CCDC115) ELISA kit
E06C1020-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 115(CCDC115) ELISA kit
E06C1020-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 115(CCDC115) ELISA kit
E06C1020-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 115(CCDC115) ELISA kit
E03C1020-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 115(CCDC115) ELISA kit
E03C1020-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 115(CCDC115) ELISA kit
E03C1020-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCDC115, Polyclonal Antibody