CCDC115, Polyclonal Antibody 

Order now: dominika@ksiazkiwnauce.pl

CCDC115 siRNA

20-abx910488
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CCDC115

YF-PA21383 50 ul
EUR 363
Description: Mouse polyclonal to CCDC115

anti-CCDC115

YF-PA21384 50 ug
EUR 363
Description: Mouse polyclonal to CCDC115

anti-CCDC115

YF-PA26724 50 ul
EUR 334
Description: Mouse polyclonal to CCDC115

CCDC115 cloning plasmid

CSB-CL853473HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 399
  • Sequence: atgggcgccaagtcggtagggcccctgcagtatgcttcccacatggagccccaggtctgcctccacgccagcgaggcccaggagggactccagaagttcaaggtggtgagagctggtgtccacgccccagaggaggtggggcctcgcgaagcaggtctgcggaggcgcaagggccc
  • Show more
Description: A cloning plasmid for the CCDC115 gene.

Anti-CCDC115 (4E9)

YF-MA19542 100 ug
EUR 363
Description: Mouse monoclonal to CCDC115

Human CCDC115 ELISA KIT

ELI-10908h 96 Tests
EUR 824

Mouse Ccdc115 ELISA KIT

ELI-11241m 96 Tests
EUR 865

Bovine CCDC115 ELISA KIT

ELI-25538b 96 Tests
EUR 928

CCDC115 ELISA KIT|Human

EF008436 96 Tests
EUR 689

Mouse CCDC115 shRNA Plasmid

20-abx977011
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCDC115 shRNA Plasmid

20-abx963438
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCDC115 Recombinant Protein (Human)

RP005839 100 ug Ask for price

CCDC115 Recombinant Protein (Rat)

RP193373 100 ug Ask for price

CCDC115 Recombinant Protein (Mouse)

RP121547 100 ug Ask for price

Coiled-Coil Domain Containing 115 (CCDC115) Antibody

20-abx111723
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Coiled-Coil Domain Containing 115 (CCDC115) Antibody

abx231345-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ccdc115 ORF Vector (Rat) (pORF)

ORF064459 1.0 ug DNA
EUR 506

CCDC115 ORF Vector (Human) (pORF)

ORF001947 1.0 ug DNA
EUR 95

Ccdc115 ORF Vector (Mouse) (pORF)

ORF040517 1.0 ug DNA
EUR 506

CCDC115 sgRNA CRISPR Lentivector set (Human)

K0383901 3 x 1.0 ug
EUR 339

Ccdc115 sgRNA CRISPR Lentivector set (Rat)

K6315801 3 x 1.0 ug
EUR 339

Ccdc115 sgRNA CRISPR Lentivector set (Mouse)

K3358501 3 x 1.0 ug
EUR 339

CCDC115 sgRNA CRISPR Lentivector (Human) (Target 1)

K0383902 1.0 ug DNA
EUR 154

CCDC115 sgRNA CRISPR Lentivector (Human) (Target 2)

K0383903 1.0 ug DNA
EUR 154

CCDC115 sgRNA CRISPR Lentivector (Human) (Target 3)

K0383904 1.0 ug DNA
EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6315802 1.0 ug DNA
EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6315803 1.0 ug DNA
EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6315804 1.0 ug DNA
EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3358502 1.0 ug DNA
EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3358503 1.0 ug DNA
EUR 154

Ccdc115 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3358504 1.0 ug DNA
EUR 154

CCDC115 Protein Vector (Mouse) (pPB-C-His)

PV162066 500 ng
EUR 603

CCDC115 Protein Vector (Mouse) (pPB-N-His)

PV162067 500 ng
EUR 603

CCDC115 Protein Vector (Mouse) (pPM-C-HA)

PV162068 500 ng
EUR 603

CCDC115 Protein Vector (Mouse) (pPM-C-His)

PV162069 500 ng
EUR 603

CCDC115 Protein Vector (Rat) (pPB-C-His)

PV257834 500 ng
EUR 603

CCDC115 Protein Vector (Rat) (pPB-N-His)

PV257835 500 ng
EUR 603

CCDC115 Protein Vector (Rat) (pPM-C-HA)

PV257836 500 ng
EUR 603

CCDC115 Protein Vector (Rat) (pPM-C-His)

PV257837 500 ng
EUR 603

CCDC115 Protein Vector (Human) (pPB-C-His)

PV007785 500 ng
EUR 329

CCDC115 Protein Vector (Human) (pPB-N-His)

PV007786 500 ng
EUR 329

CCDC115 Protein Vector (Human) (pPM-C-HA)

PV007787 500 ng
EUR 329

CCDC115 Protein Vector (Human) (pPM-C-His)

PV007788 500 ng
EUR 329

Ccdc115 3'UTR GFP Stable Cell Line

TU153233 1.0 ml Ask for price

Ccdc115 3'UTR Luciferase Stable Cell Line

TU103233 1.0 ml Ask for price

Ccdc115 3'UTR Luciferase Stable Cell Line

TU201750 1.0 ml Ask for price

Ccdc115 3'UTR GFP Stable Cell Line

TU251750 1.0 ml Ask for price

CCDC115 3'UTR GFP Stable Cell Line

TU053697 1.0 ml
EUR 1394

CCDC115 3'UTR Luciferase Stable Cell Line

TU003697 1.0 ml
EUR 1394

Goat Coiled coil domain containing protein 115(CCDC115) ELISA kit

E06C1020-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 115(CCDC115) ELISA kit

E06C1020-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 115(CCDC115) ELISA kit

E06C1020-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 115(CCDC115) ELISA kit

E03C1020-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 115(CCDC115) ELISA kit

E03C1020-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 115(CCDC115) ELISA kit

E03C1020-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 115(CCDC115) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCDC115, Polyclonal Antibody