TMEM95, Polyclonal Antibody 

Order now: dominika@ksiazkiwnauce.pl

TMEM95 Polyclonal Antibody, FITC Conjugated

A63678 100 µg
EUR 570.55
Description: fast delivery possible

TMEM95 Polyclonal Antibody, Biotin Conjugated

A63679 100 µg
EUR 570.55
Description: reagents widely cited

TMEM95 Antibody (HRP)

20-abx305738
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TMEM95 Antibody (FITC)

20-abx305739
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TMEM95 Antibody (Biotin)

20-abx305740
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TMEM95 siRNA

20-abx937473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM95 siRNA

20-abx937474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM95 Antibody, HRP conjugated

1-CSB-PA023899LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM95. Recognizes TMEM95 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TMEM95 Antibody, FITC conjugated

1-CSB-PA023899LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM95. Recognizes TMEM95 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TMEM95 Antibody, Biotin conjugated

1-CSB-PA023899LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM95. Recognizes TMEM95 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TMEM95 cloning plasmid

CSB-CL023899HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: ATGTGGAGGCTGGCACTAGGCGGGGTTTTCCTGGCAGCCGCCCAGGCTTGTGTCTTCTGTCGCCTCCCAGCCCACGACTTGTCAGGCCGCCTGGCTCGGCTCTGCAGCCAGATGGAGGCCAGGCAGAAGGAATGTGGGGCCTCCCCAGACTTCTCGGCCTTTGCCTTAGATGAGGT
  • Show more
Description: A cloning plasmid for the TMEM95 gene.

Transmembrane Protein 95 (TMEM95) Antibody

20-abx305737
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse TMEM95 shRNA Plasmid

20-abx984333
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMEM95 shRNA Plasmid

20-abx967269
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMEM95 Recombinant Protein (Human)

RP044299 100 ug Ask for price

TMEM95 Recombinant Protein (Rat)

RP233900 100 ug Ask for price

TMEM95 Recombinant Protein (Mouse)

RP179978 100 ug Ask for price

Tmem95 ORF Vector (Mouse) (pORF)

ORF059994 1.0 ug DNA
EUR 506

Tmem95 ORF Vector (Rat) (pORF)

ORF077968 1.0 ug DNA
EUR 506

TMEM95 ORF Vector (Human) (pORF)

ORF014767 1.0 ug DNA
EUR 354

pECMV-Tmem95-m-FLAG Plasmid

PVT15550 2 ug
EUR 325

TMEM95 ELISA Kit (Human) (OKCA00844)

OKCA00844 96 Wells
EUR 833
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

TMEM95 sgRNA CRISPR Lentivector set (Human)

K2395201 3 x 1.0 ug
EUR 339

Tmem95 sgRNA CRISPR Lentivector set (Rat)

K6210001 3 x 1.0 ug
EUR 339

Tmem95 sgRNA CRISPR Lentivector set (Mouse)

K3147601 3 x 1.0 ug
EUR 339

Human Transmembrane protein 95, TMEM95 ELISA KIT

ELI-41885h 96 Tests
EUR 824

TMEM95 sgRNA CRISPR Lentivector (Human) (Target 1)

K2395202 1.0 ug DNA
EUR 154

TMEM95 sgRNA CRISPR Lentivector (Human) (Target 2)

K2395203 1.0 ug DNA
EUR 154

TMEM95 sgRNA CRISPR Lentivector (Human) (Target 3)

K2395204 1.0 ug DNA
EUR 154

Tmem95 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6210002 1.0 ug DNA
EUR 154

Tmem95 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6210003 1.0 ug DNA
EUR 154

Tmem95 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6210004 1.0 ug DNA
EUR 154

Human Transmembrane protein 95(TMEM95) ELISA kit

CSB-EL023899HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 95 (TMEM95) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Transmembrane protein 95(TMEM95) ELISA kit

1-CSB-EL023899HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transmembrane protein 95(TMEM95) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Tmem95 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3147602 1.0 ug DNA
EUR 154

Tmem95 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3147603 1.0 ug DNA
EUR 154

Tmem95 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3147604 1.0 ug DNA
EUR 154

TMEM95 Protein Vector (Human) (pPB-C-His)

PV059065 500 ng
EUR 481

TMEM95 Protein Vector (Human) (pPB-N-His)

PV059066 500 ng
EUR 481

TMEM95 Protein Vector (Human) (pPM-C-HA)

PV059067 500 ng
EUR 481

TMEM95 Protein Vector (Human) (pPM-C-His)

PV059068 500 ng
EUR 481

TMEM95 Protein Vector (Rat) (pPB-C-His)

PV311870 500 ng
EUR 603

TMEM95 Protein Vector (Rat) (pPB-N-His)

PV311871 500 ng
EUR 603

TMEM95 Protein Vector (Rat) (pPM-C-HA)

PV311872 500 ng
EUR 603

TMEM95 Protein Vector (Rat) (pPM-C-His)

PV311873 500 ng
EUR 603

TMEM95 Protein Vector (Mouse) (pPB-C-His)

PV239974 500 ng
EUR 603

TMEM95 Protein Vector (Mouse) (pPB-N-His)

PV239975 500 ng
EUR 603

TMEM95 Protein Vector (Mouse) (pPM-C-HA)

PV239976 500 ng
EUR 603

TMEM95 Protein Vector (Mouse) (pPM-C-His)

PV239977 500 ng
EUR 603

Tmem95 3'UTR GFP Stable Cell Line

TU170817 1.0 ml Ask for price

TMEM95 3'UTR GFP Stable Cell Line

TU075801 1.0 ml
EUR 1394

Tmem95 3'UTR Luciferase Stable Cell Line

TU120817 1.0 ml Ask for price

TMEM95 3'UTR Luciferase Stable Cell Line

TU025801 1.0 ml
EUR 1394

Tmem95 3'UTR Luciferase Stable Cell Line

TU222179 1.0 ml Ask for price

Tmem95 3'UTR GFP Stable Cell Line

TU272179 1.0 ml Ask for price

TMEM95 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650545 1.0 ug DNA
EUR 514

TMEM95 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650549 1.0 ug DNA
EUR 514

TMEM95 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650550 1.0 ug DNA
EUR 514

TMEM95 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2395205 3 x 1.0 ug
EUR 376

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6210005 3 x 1.0 ug
EUR 376

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3147605 3 x 1.0 ug
EUR 376

TMEM95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2395206 1.0 ug DNA
EUR 167

TMEM95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2395207 1.0 ug DNA
EUR 167

TMEM95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2395208 1.0 ug DNA
EUR 167

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6210006 1.0 ug DNA
EUR 167

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6210007 1.0 ug DNA
EUR 167

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6210008 1.0 ug DNA
EUR 167

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3147606 1.0 ug DNA
EUR 167

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3147607 1.0 ug DNA
EUR 167

Tmem95 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3147608 1.0 ug DNA
EUR 167

TMEM95 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650546 1.0 ug DNA
EUR 514

TMEM95 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650547 1.0 ug DNA
EUR 572

TMEM95 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650548 1.0 ug DNA
EUR 572

Polyclonal RARA polyclonal antibody

APR00370G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RARA polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal ETO polyclonal antibody

APR00372G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ETO polyclonal . This antibody is tested and proven to work in the following applications:

TMEM95, Polyclonal Antibody