CMTM5 AK Polyclonal Antibody 

Order now:

CMTM5 Polyclonal Antibody

ABP53216-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CMTM5
  • Applications tips:
Description: A polyclonal antibody for detection of CMTM5 from Human. This CMTM5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CMTM5

CMTM5 Polyclonal Antibody

ABP53216-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CMTM5
  • Applications tips:
Description: A polyclonal antibody for detection of CMTM5 from Human. This CMTM5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CMTM5

CMTM5 Polyclonal Antibody

ABP53216-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CMTM5
  • Applications tips:
Description: A polyclonal antibody for detection of CMTM5 from Human. This CMTM5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CMTM5

CMTM5 Polyclonal Antibody

A66694 100 µg
EUR 570.55
Description: Ask the seller for details

CMTM5 Polyclonal Antibody

41856-100ul 100ul
EUR 252

CMTM5 Polyclonal Antibody

41856-50ul 50ul
EUR 187

CMTM5 Polyclonal Conjugated Antibody

C41856 100ul
EUR 397

AK Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK. Recognizes AK from Penaeus monodon. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CMTM5 Antibody

ABD9387 100 ug
EUR 438

CMTM5 Antibody

36885-100ul 100ul
EUR 252

CMTM5 Antibody

DF9387 200ul
EUR 304
Description: CMTM5 Antibody detects endogenous levels of total CMTM5.

CMTM5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CMTM5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CMTM5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CMTM5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CMTM5 Polyclonal Antibody, HRP Conjugated

A66695 100 µg
EUR 570.55
Description: The best epigenetics products

CMTM5 Polyclonal Antibody, FITC Conjugated

A66696 100 µg
EUR 570.55
Description: kits suitable for this type of research

CMTM5 Polyclonal Antibody, Biotin Conjugated

A66697 100 µg
EUR 570.55
Description: fast delivery possible

CMTM5 Conjugated Antibody

C36885 100ul
EUR 397

Anti-CMTM5 Antibody

A10739 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CMTM5 Antibody (CMTM5) detection.tested for IHC, WB in Human.

Anti-CMTM5 antibody

STJ96850 200 µl
EUR 197
Description: Rabbit polyclonal to CMTM5.

Anti-CMTM5 antibody

STJ23177 100 µl
EUR 277
Description: This gene encodes a member of the chemokine-like factor superfamily. This family of genes encodes multi-pass membrane proteins that are similar to both the chemokine and the transmembrane 4 superfamilies of signaling molecules. The encoded protein may exhibit tumor suppressor activity. Alternative splicing results in multiple transcript variants.


B4713-10 10 mg
EUR 206


B4713-25 25 mg
EUR 419


B4713-5 5 mg
EUR 132


B4713-50 50 mg
EUR 706


HY-101465 50mg
EUR 463


HY-16691 100mg
EUR 877


GL8955-25MG 25 mg
EUR 482


GL8955-5MG 5 mg
EUR 172

Arginine Kinase (AK) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AK Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK. Recognizes AK from Penaeus monodon. This antibody is HRP conjugated. Tested in the following application: ELISA

AK Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK. Recognizes AK from Penaeus monodon. This antibody is FITC conjugated. Tested in the following application: ELISA

AK Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK. Recognizes AK from Penaeus monodon. This antibody is Biotin conjugated. Tested in the following application: ELISA


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21974 50 ul
EUR 363
Description: Mouse polyclonal to CMTM5


YF-PA26832 50 ul
EUR 334
Description: Mouse polyclonal to CMTM5

CMTM5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CMTM5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CMTM5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM5. Recognizes CMTM5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Arginine Kinase (AK) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arginine Kinase (AK) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arginine Kinase (AK) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CMTM5 Rabbit pAb

A2942-100ul 100 ul
EUR 308

CMTM5 Rabbit pAb

A2942-200ul 200 ul
EUR 459

CMTM5 Rabbit pAb

A2942-20ul 20 ul Ask for price

CMTM5 Rabbit pAb

A2942-50ul 50 ul
EUR 223

CMTM5 Blocking Peptide

DF9387-BP 1mg
EUR 195

CMTM5 cloning plasmid

CSB-CL842660HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 471
  • Sequence: atgctcagtgctcgagatcgccgggaccggcaccctgaggagggggtagttgcagagctccagggcttcgcggtggacaaggccttcctcacctcccacaagggcatcctgctggaaaccgagctggccctgaccctcatcatcttcatctgcttcacggcctccatctctgccta
  • Show more
Description: A cloning plasmid for the CMTM5 gene.


PVT13688 2 ug
EUR 391

Anti-CMTM5 (2B10)

YF-MA19765 50 ug
EUR 363
Description: Mouse monoclonal to CMTM5

Anti-CMTM5 (2B10)

YF-MA19766 200 ul
EUR 363
Description: Mouse monoclonal to CMTM5

Mouse CMTM5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CMTM5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Cmtm5 ELISA KIT

ELI-33603m 96 Tests
EUR 865


ELI-50965h 96 Tests
EUR 824

CMTM5 AK Polyclonal Antibody