Human IL28B(Interleukin 28B) ELISA Kit
Order now: dominika@ksiazkiwnauce.pl
Human Interleukin 28B (IL28B) ELISA Kit |
RDR-IL28B-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 481 |
Human Interleukin 28B (IL28B) ELISA Kit |
RDR-IL28B-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 665 |
Human IL28B/ Interleukin-28B ELISA Kit |
E2925Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Interleukin 28B (IL28B) ELISA Kit |
20-abx152037 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Interleukin 28B (IL28B) ELISA Kit |
20-abx258388 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Interleukin 28B (IL28B) ELISA Kit |
abx251386-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Interleukin 28B (IL28B) ELISA Kit |
SEC028Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B) ELISA Kit |
SEC028Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B) ELISA Kit |
SEC028Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B) ELISA Kit |
SEC028Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B) ELISA Kit |
4-SEC028Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3
- Interferon, Lambda 3
- Cytokine Zcyto22
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 28B (IL28B) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Active Interleukin 28B (IL28B) |
4-APC028Hu01 |
Cloud-Clone |
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
-
EUR 996.00
-
EUR 1892.00
-
EUR 610.00
-
EUR 6820.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.6kDa
- Isoelectric Point: 9
|
Description: Recombinant Human Interleukin 28B expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells |
Interleukin 28B (IL28B) Antibody |
20-abx131937 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Interleukin 28B (IL28B) Antibody |
20-abx004319 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Interleukin 28B (IL28B) Antibody |
abx029111-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Interleukin 28B (IL28B) Antibody |
abx029111-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Human Interleukin 28B (IL28B) CLIA Kit |
20-abx490724 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Interleukin 28B (IL28B)CLIA Kit |
SCC028Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B)CLIA Kit |
SCC028Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B)CLIA Kit |
SCC028Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B)CLIA Kit |
SCC028Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 28B (IL28B) CLIA Kit |
4-SCC028Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3061.00
-
EUR 747.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 28B Clia kit. Alternative names of the recognized antigen: IFNL3
- Interferon, Lambda 3
- Cytokine Zcyto22
|
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B)serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids |
ELISA kit for Human IL28B (Interleukin 28B) |
ELK1783 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 28B (IL28B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
- Show more
|
Description: A sandwich ELISA kit for detection of Interleukin 28B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Interleukin 28B (IL28B) Antibody (FITC) |
20-abx273652 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Interleukin 28B (IL28B) Antibody (Biotin) |
20-abx272239 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Interleukin 28B (IL28B) Protein (Active) |
20-abx655729 |
Abbexa |
-
EUR 1121.00
-
EUR 411.00
-
EUR 3724.00
-
EUR 1358.00
-
EUR 759.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Interleukin 28B (IL28B) Monoclonal Antibody (Human) |
4-MAC028Hu22 |
Cloud-Clone |
-
EUR 255.00
-
EUR 2642.00
-
EUR 655.00
-
EUR 322.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B) |
High Sensitive Human Interleukin 28B (IL28B) ELISA Kit |
HEC028Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
High Sensitive Human Interleukin 28B (IL28B) ELISA Kit |
HEC028Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
High Sensitive Human Interleukin 28B (IL28B) ELISA Kit |
HEC028Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
High Sensitive Human Interleukin 28B (IL28B) ELISA Kit |
HEC028Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
High Sensitive Human Interleukin 28B (IL28B) ELISA Kit |
4-HEC028Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3
- Interferon, Lambda 3
- Cytokine Zcyto22
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Interleukin 28B (IL28B) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit |
MEC028Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5804.88 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B). |
Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit |
MEC028Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 565.7 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B). |
Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit |
MEC028Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 765.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B). |
Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit |
MEC028Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3143.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B). |
Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit |
4-MEC028Mu |
Cloud-Clone |
-
EUR 5855.00
-
EUR 3094.00
-
EUR 766.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3
- Interferon, Lambda 3
- Cytokine Zcyto22
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 28B (IL28B) in samples from n/a with no significant corss-reactivity with analogues from other species. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), APC |
4-MAC028Hu22-APC |
Cloud-Clone |
-
EUR 358.00
-
EUR 3455.00
-
EUR 957.00
-
EUR 458.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with APC. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), Biotinylated |
4-MAC028Hu22-Biotin |
Cloud-Clone |
-
EUR 320.00
-
EUR 2592.00
-
EUR 760.00
-
EUR 394.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with Biotin. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), Cy3 |
4-MAC028Hu22-Cy3 |
Cloud-Clone |
-
EUR 435.00
-
EUR 4565.00
-
EUR 1235.00
-
EUR 569.00
-
EUR 258.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with Cy3. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), FITC |
4-MAC028Hu22-FITC |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with FITC. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), HRP |
4-MAC028Hu22-HRP |
Cloud-Clone |
-
EUR 327.00
-
EUR 3011.00
-
EUR 846.00
-
EUR 413.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with HRP. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), PE |
4-MAC028Hu22-PE |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with PE. |
Recombinant Human IFNL3/IL28B/Interleukin-28B Protein |
RP00219 |
Abclonal |
5 μg |
EUR 155 |
IL28B Human, Interleukin 28B Human Recombinant Protein, Sf9 |
PROTQ8IZI9-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: IL 28B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (22-196 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 181 amino acids and having a molecular mass of 20.4kDa.;IL 28B shows multiple bands between 18-28kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques. |
Interleukin 28B (IL28B) Monoclonal Antibody (Human), APC-Cy7 |
4-MAC028Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 596.00
-
EUR 6790.00
-
EUR 1795.00
-
EUR 796.00
-
EUR 329.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with APC-Cy7. |
Human IL-28B(Interleukin-28B) ELISA Kit |
EH2057 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.6-1000 pg/ml
- Uniprot ID: Q8IZI9
- Alias: IL28B(Interleukin-28B)/IL-28B/Interleukin-28C/IL-28C/Interferon lambda-4/IFN-lambda-4/Cytokine Zcyto22/Interferon lambda-3/IFN-lambda-3/IL28C/IL-28B/interferon, lambda 3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human Interleukin 28B(IL-28B)ELISA Kit |
GA-E0089HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Interleukin 28B(IL-28B)ELISA Kit |
GA-E0089HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Interleukin 28B,IL-28B ELISA Kit |
201-12-0042 |
SunredBio |
96 tests |
EUR 440 |
- This Interleukin 28B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Interleukin 28B(IL-28B) ELISA kit |
CSB-E13296h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28B (IL-28B) in samples from serum, plasma, cellculturesupernats, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Interleukin 28B(IL-28B) ELISA kit |
1-CSB-E13296h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28B(IL-28B) in samples from serum, plasma, cellculturesupernats, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human IL-28B (Interleukin 28B) |
E-EL-H5508 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's IL-28B ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-28B. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human IL-28B (Interleukin 28B) in samples from Serum, Plasma, Cell supernatant |
IL-28B Interleukin-28B Human Recombinant Protein |
PROTQ8IZI9 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-28B Human Recombinant produced in HEK cells is a non-glycosylated monomer, having a total molecular weight of 24kDa.;The IL28B is purified by proprietary chromatographic techniques. |
IL-28B Interleukin-28B Mouse Recombinant Protein |
PROTQ8CGK6 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: IL-28B Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 174 amino acids and having a molecular mass of 19.6kDa.;The IL28B is purified by proprietary chromatographic techniques. |
Mouse pre-microRNA Expression Construct mir-28b |
MMIR-28b-PA-1 |
SBI |
Bacterial Streak |
EUR 684 |
|
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 |
CS26-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 |
CS26-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 |
CS26-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 |
CS26-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His) |
CA25-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His) |
CA25-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His) |
CA25-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His) |
CA25-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4. |
IL28B Protein |
20-abx261676 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
IL28B Protein |
20-abx263021 |
Abbexa |
-
EUR 328.00
-
EUR 7023.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
IL28B Antibody |
32947-100ul |
SAB |
100ul |
EUR 252 |
IL28B Antibody |
DF8984 |
Affbiotech |
200ul |
EUR 304 |
Description: IL28B Antibody detects endogenous levels of total IL28B. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
ELISA kit for Human IL-28B/IFN-lambda3 |
EK5786 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IL-28B/IFN-lambda3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
IL-28B ELISA Kit (Human) : 96 Wells (OKAG00147) |
OKAG00147 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA).;Species reactivity: Human;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 32 pg/mL |
IL28B Conjugated Antibody |
C32947 |
SAB |
100ul |
EUR 397 |
IL28B Polyclonal Antibody |
ES9175-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IL28B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IL28B Polyclonal Antibody |
ES9175-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IL28B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IL28B Polyclonal Antibody |
ABP58926-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180 |
IL28B Polyclonal Antibody |
ABP58926-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180 |
IL28B Polyclonal Antibody |
ABP58926-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180 |
IL28B / IFNL3 Antibody |
abx234263-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
IL28B Blocking Peptide |
DF8984-BP |
Affbiotech |
1mg |
EUR 195 |
IL28B cloning plasmid |
CSB-CL810313HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 591
- Sequence: atgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagttcctgtcgccaggctccgcggggctctcccggatgcaaggggctgccacatagcccagttcaagtccctgtctccacaggagctgcaggcctttaagagggccaaagatgc
- Show more
|
Description: A cloning plasmid for the IL28B gene. |
Anti-IL28B antibody |
STJ190333 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IL28B |
Human Interferon Lambda 3 (IL28B) CLIA Kit |
20-abx190279 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Coiled-Coil Domain Containing 28B (CCDC28B) ELISA Kit |
20-abx386339 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
IL28B ORF Vector (Human) (pORF) |
ORF013352 |
ABM |
1.0 ug DNA |
EUR 354 |
Human CellExp? IL-28B, Human Recombinant |
6472-10 |
Biovision |
|
EUR 343 |
Human CellExp? IL-28B, Human Recombinant |
6472-50 |
Biovision |
|
EUR 1333 |
Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit |
E01C1070-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit |
E01C1070-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit |
E01C1070-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
IL28B sgRNA CRISPR Lentivector set (Human) |
K1083001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Polyclonal IL-28B Antibody |
APR16822G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL-28B . This antibody is tested and proven to work in the following applications: |
mmu-miR-28b Primers |
MPM02272 |
ABM |
150 ul / 10 uM |
EUR 121 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Il28b ORF Vector (Mouse) (pORF) |
ORF047875 |
ABM |
1.0 ug DNA |
EUR 506 |
IL28B sgRNA CRISPR Lentivector (Human) (Target 1) |
K1083002 |
ABM |
1.0 ug DNA |
EUR 154 |
IL28B sgRNA CRISPR Lentivector (Human) (Target 2) |
K1083003 |
ABM |
1.0 ug DNA |
EUR 154 |
IL28B sgRNA CRISPR Lentivector (Human) (Target 3) |
K1083004 |
ABM |
1.0 ug DNA |
EUR 154 |
IL28B Protein Vector (Human) (pPB-C-His) |
PV053405 |
ABM |
500 ng |
EUR 481 |
IL28B Protein Vector (Human) (pPB-N-His) |
PV053406 |
ABM |
500 ng |
EUR 481 |
IL28B Protein Vector (Human) (pPM-C-HA) |
PV053407 |
ABM |
500 ng |
EUR 481 |
IL28B Protein Vector (Human) (pPM-C-His) |
PV053408 |
ABM |
500 ng |
EUR 481 |
Recombinant Human IL28B Protein, His, Insect-10ug |
QP12417-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human IL28B Protein, His, Insect-1mg |
QP12417-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human IL28B Protein, His, Insect-2ug |
QP12417-2ug |
EnQuireBio |
2ug |
EUR 155 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
mmu-miR-28b miRNA Inhibitor |
MIM01585 |
ABM |
2 x 5.0 nmol |
EUR 176 |
mmu-miR-28b miRNA Antagomir |
MNM01585 |
ABM |
2 x 5.0 nmol |
EUR 329 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human IL28B(Interleukin 28B) ELISA Kit