HMGB1 detection kit
Order now: dominika@ksiazkiwnauce.pl
Goat HMGB1 ELISA Kit |
EGTH0016 |
Abclonal |
96Tests |
EUR 521 |
Bovine HMGB1 ELISA Kit |
EBH0016 |
Abclonal |
96Tests |
EUR 521 |
Canine HMGB1 ELISA Kit |
ECH0016 |
Abclonal |
96Tests |
EUR 521 |
Chicken HMGB1 ELISA Kit |
ECKH0016 |
Abclonal |
96Tests |
EUR 521 |
Anserini HMGB1 ELISA Kit |
EAH0016 |
Abclonal |
96Tests |
EUR 521 |
Porcine HMGB1 ELISA Kit |
EPH0016 |
Abclonal |
96Tests |
EUR 521 |
Rat HMGB1 ELISA Kit |
ERH0016 |
Abclonal |
96Tests |
EUR 521 |
Rabbit HMGB1 ELISA Kit |
ERTH0016 |
Abclonal |
96Tests |
EUR 521 |
Sheep HMGB1 ELISA Kit |
ESH0016 |
Abclonal |
96Tests |
EUR 521 |
Mouse HMGB1 ELISA Kit |
EMH0016 |
Abclonal |
96Tests |
EUR 521 |
Monkey HMGB1 ELISA Kit |
EMKH0016 |
Abclonal |
96Tests |
EUR 521 |
Rat HMGB1 ELISA Kit |
STJ150371 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids |
Human HMGB1 ELISA Kit |
STJ150454 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids |
Mouse HMGB1 ELISA Kit |
STJ150484 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Mouse serum, plasma and other biological fluids |
HMGB1 Antibody |
AF7020 |
Affbiotech |
200ul |
EUR 376 |
Description: HMGB1 antibody detects endogenous levels of total HMGB1. |
HMGB1 Protein |
20-abx600027 |
Abbexa |
-
EUR 1887.00
-
EUR 1261.00
-
EUR 1372.00
-
EUR 968.00
|
|
- Shipped within 1-2 months.
|
HMGB1 siRNA |
20-abx902481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HMGB1 Protein |
20-abx260452 |
Abbexa |
-
EUR 230.00
-
EUR 2332.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
HMGB1 siRNA |
20-abx919601 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HMGB1 siRNA |
20-abx919602 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bovine HMGB1 |
9050 |
Chondrex |
1 mg/ml x 0.1 ml |
EUR 309.55 |
Description: Bovine HMGB1 |
HMGB1 antibody |
70R-31573 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HMGB1 antibody |
HMGB1 antibody |
38424-100ul |
SAB |
100ul |
EUR 252 |
HMGB1 Antibody |
33661-100ul |
SAB |
100ul |
EUR 252 |
HMGB1 Antibody |
33661-50ul |
SAB |
50ul |
EUR 187 |
HMGB1 Antibody |
48606-100ul |
SAB |
100ul |
EUR 333 |
HMGB1 Antibody |
48606-50ul |
SAB |
50ul |
EUR 239 |
HMGB1 antibody |
10R-1114 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Mouse monoclonal HMGB1 antibody |
HMGB1 protein |
30R-1150 |
Fitzgerald |
100 ug |
EUR 457 |
Description: Purified recombinant Human HMGB1 protein |
HMGB1 antibody |
70R-17757 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal HMGB1 antibody |
HMGB1 antibody |
70R-15458 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HMGB1 antibody |
HMGB1 Antibody |
DF7008 |
Affbiotech |
200ul |
EUR 304 |
Description: HMGB1 Antibody detects endogenous levels of total HMGB1. |
HMGB1 Antibody |
1-CSB-PA995991 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
HMGB1 Antibody |
DF3077 |
Affbiotech |
200ul |
EUR 304 |
Description: HMGB1 Antibody detects endogenous levels of total HMGB1. |
HMGB1 Antibody |
1-CSB-PA005927 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
HMGB1 Antibody |
1-CSB-PA002937 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
HMGB1 Antibody |
1-CSB-PA010553GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
HMGB1 Antibody |
1-CSB-PA010553YA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
HMGB1 Antibody |
1-CSB-PA225274 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
HMGB1 Antibody |
CSB-PA049959- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
HMGB1 Antibody |
CSB-PA049959-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
HMGB1 Antibody |
1-CSB-PA01604A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
anti-HMGB1 |
YF-PA12378 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to HMGB1 |
anti-HMGB1 |
YF-PA23886 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to HMGB1 |
HMGB1, human |
RC712-17 |
Bio Basic |
50ug |
EUR 169.63 |
- Product category: Proteins/Recombinant Proteins/Other
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Apoptosis Detection Kit |
ANXVKB-100T |
ImmunoStep |
100 test |
EUR 464.7 |
Apoptosis Detection Kit |
ANXVKCFB-100T |
ImmunoStep |
100 test |
EUR 412.7 |
Apoptosis Detection Kit |
ANXVKCFB7-100T |
ImmunoStep |
100 test |
EUR 412.7 |
Apoptosis Detection Kit |
ANXVKDY-100T |
ImmunoStep |
100 test |
EUR 389.3 |
Apoptosis Detection Kit |
ANXVKF-100T |
ImmunoStep |
100 test |
EUR 329.5 |
Apoptosis Detection Kit |
ANXVKF7-100T |
ImmunoStep |
100 test |
EUR 329.5 |
Apoptosis Detection Kit |
ANXVKPE-100T |
ImmunoStep |
100 test |
EUR 346.4 |
Formaldehyde Detection Kit |
K001-F1 |
Arbor Assays |
2x96 well plate |
EUR 425 |
Autophagy Detection Kit |
abx299014-50tests |
Abbexa |
50 tests |
EUR 523 |
|
Autophagy Detection Kit |
abx299015-200tests |
Abbexa |
200 tests |
EUR 871 |
|
Senescence Detection Kit |
55R-1370 |
Fitzgerald |
250 tests |
EUR 712 |
Description: Senescence Detection Kit for use in the research laboratory |
SEB Detection Kit |
6030 |
Chondrex |
1 kit |
EUR 553.15 |
Description: SEB Detection Kit |
Senescence Detection Kit |
K2030-250 |
ApexBio |
250 Staining |
EUR 460 |
Senescence Detection Kit |
K320-250 |
Biovision |
|
EUR 468 |
Ubiquitin Detection Kit |
SKT-131-20 |
Stressmarq |
20 assays |
EUR 495 |
- The covalent attachment of ubiquitin to proteins (ubiquitination) plays a fundamental role in the regulation of cellular function through biological events including cell cycle, differentiation, immune responses, DNA repair, chromatin structure, tran
- Show more
|
Description: Purification Detection kit used to capture, detect, identify and characterise ubiquitinated proteins and free chains from samples.
in Cell Lysates, Tissue samples from all species |
Glutathione Detection Kit |
SKT-202-96 |
Stressmarq |
1 plate of 96 wells |
EUR 428 |
- Glutathione (L-?-glutamyl-L-cysteinylglycine
- GSH) is the highest concentration non-protein thiol in mammalian cells and is present in concentrations of 0.5 - 10 mM (1). GSH plays a key role in many biological processes, including the synthesis of pr
- Show more
|
Description: Direct Fluorometric detection assay to measure the total GSH content in Whole Blood, Serum, EDTA Plasma, Heparin Plasma, Erythrocytes, Urine, Cell Lysates, Tissue samples from all species |
Guinea Pig HMGB1 ELISA Kit |
EGH0016 |
Abclonal |
96Tests |
EUR 521 |
[One Step] HMGB1 antibody Kit |
RK05718 |
Abclonal |
50 ul |
EUR 240 |
HMGB1 ELISA Kit (Rat) (OKAN06040) |
OKAN06040 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: heparin binding protein that facilitates neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL |
HMGB1 ELISA Kit (Human) (OKAN06342) |
OKAN06342 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL |
HMGB1 ELISA Kit (Human) (OKAN06343) |
OKAN06343 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL |
HMGB1 ELISA Kit (Mouse) (OKAN06405) |
OKAN06405 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL |
HMGB1 ELISA Kit (Mouse) (OKCD04072) |
OKCD04072 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.29 pg/mL |
HMGB1 ELISA Kit (Rat) (OKCD04073) |
OKCD04073 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL |
HMGB1 ELISA Kit (Human) (OKCD04074) |
OKCD04074 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL |
HMGB1 ELISA Kit (Chicken) (OKEH03961) |
OKEH03961 |
Aviva Systems Biology |
96 Wells |
EUR 844 |
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. Nuclear functions are attributed to fully reduced HGMB1. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA, DNA-containing cruciforms or bent structures, supercoiled DNA and ZDNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters. Can restructure the canonical nucleosome. Proposed to be an universal biosensor for nucleic acids. May promote inflammatory response to sterile and infectious signals and may be involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm may function as sensor and/or chaperone for immunogenic nucleic acids, and mediate autophagy. May act as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL |
HMGB1 ELISA Kit (Dog) (OKCA02054) |
OKCA02054 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
HMGB1 ELISA Kit (Pig) (OKEH07385) |
OKEH07385 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059ng/mL |
HMGB1 ELISA Kit (Rabbit) (OKWB00408) |
OKWB00408 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: ;Species reactivity: Rabbit;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL |
HMGB1 Blocking Peptide |
AF7020-BP |
Affbiotech |
1mg |
EUR 195 |
HMGB1 Conjugated Antibody |
C48606 |
SAB |
100ul |
EUR 397 |
HMGB1 Conjugated Antibody |
C33661 |
SAB |
100ul |
EUR 397 |
HMGB1 cloning plasmid |
CSB-CL010553HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 648
- Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
- Show more
|
Description: A cloning plasmid for the HMGB1 gene. |
HMGB1 cloning plasmid |
CSB-CL010553HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 648
- Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
- Show more
|
Description: A cloning plasmid for the HMGB1 gene. |
HMGB1/HMG-1 |
E21-357 |
EnoGene |
10ug |
EUR 343 |
anti- HMGB1 antibody |
FNab10218 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- Immunogen: High mobility group protein B1
- Uniprot ID: P09429
- Gene ID: 3146
|
Description: Antibody raised against HMGB1 |
anti- HMGB1 antibody |
FNab03924 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: high-mobility group box 1
- Uniprot ID: P09429
- Gene ID: 3146
- Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
|
Description: Antibody raised against HMGB1 |
HMGB1 (AcK12) Antibody |
20-abx141151 |
Abbexa |
-
EUR 384.00
-
EUR 606.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
HMGB1 Blocking Peptide |
20-abx061647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HMGB1 Blocking Peptide |
20-abx061850 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-HMGB1 Antibody |
A00066-1 |
BosterBio |
100ug/vial |
EUR 334 |
HMGB1 Polyclonal Antibody |
A-2700 |
EpiGentek |
100 µl |
EUR 724.25 |
Description: The best epigenetics products |
HMGB1 Rabbit pAb |
A0718-100ul |
Abclonal |
100 ul |
EUR 308 |
HMGB1 Rabbit pAb |
A0718-200ul |
Abclonal |
200 ul |
EUR 459 |
HMGB1 Rabbit pAb |
A0718-20ul |
Abclonal |
20 ul |
Ask for price |
HMGB1 Rabbit pAb |
A0718-50ul |
Abclonal |
50 ul |
Ask for price |
HMGB1 Polyclonal Antibody |
A51497 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
HMGB1 protein (Mouse) |
30R-2278 |
Fitzgerald |
100 ug |
EUR 2012 |
Description: Purified recombinant Mouse HMGB1 protein |
HMGB1 antibody (HRP) |
60R-2188 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HMGB1 antibody (HRP) |
HMGB1 antibody (FITC) |
60R-2189 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HMGB1 antibody (FITC) |
HMGB1 antibody (biotin) |
60R-2190 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HMGB1 antibody (biotin) |
HMGB1 Blocking Peptide |
DF7008-BP |
Affbiotech |
1mg |
EUR 195 |
HMGB1 Blocking Peptide |
DF3077-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant Human HMGB1 |
P0194 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: P09429
|
Description: Recombinant Human protein for HMGB1 |
Anti-HMGB1 antibody |
STJ29816 |
St John's Laboratory |
100 µl |
EUR 457 |
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein. |
Anti-HMGB1 antibody |
STJ24037 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein. |
Anti-HMGB1 antibody |
STJ24039 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein. |
Anti-HMGB1 (1B2) |
YF-MA13482 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HMGB1 |
Anti-HMGB1 (1D10) |
YF-MA13483 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HMGB1 |
Anti-HMGB1 (1D9) |
YF-MA13484 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HMGB1 |
Anti-HMGB1 (1D5) |
YF-MA10425 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HMGB1 |
Anti-HMGB1 (1B11) |
YF-MA10426 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HMGB1 |
Anti-HMGB1 (2F6) |
YF-MA10427 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HMGB1 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
HMGB1 ELISA Kit (Pig | Swine) (OKCA02201) |
OKCA02201 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.;Species reactivity: Pig | Swine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL. |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
HMGB1 detection kit