Rabbit anti-human CALCB PaB

Rabbit anti-human CALCB PaB 

Order now: dominika@ksiazkiwnauce.pl

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Anti-CALCB antibody
STJ110404	St John's Laboratory	100 µl	EUR 277

CALCB Antibody
1-CSB-PA004435ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CALCB. Recognizes CALCB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CALCB siRNA
20-abx910139	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CALCB siRNA
20-abx910140	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human CALCB ELISA Kit
ELA-E0876h	Lifescience Market	96 Tests	EUR 824

CALCB ELISA KIT|Human
EF003933	Lifescience Market	96 Tests	EUR 689

Human CALCB shRNA Plasmid
20-abx950559	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CALCB Recombinant Protein (Human)
RP005449	ABM	100 ug	Ask for price

pAb rabbit anti-human EPO
CT282	U-CyTech	0.5 mg	EUR 184

CALCB Polyclonal Antibody
31440-100ul	SAB	100ul	EUR 252

CALCB Polyclonal Antibody
31440-50ul	SAB	50ul	EUR 187

CALCA/CALCB antibody
31944-100ul	SAB	100ul	EUR 252

CALCA/CALCB antibody
31944-50ul	SAB	50ul	EUR 187

CALCB cloning plasmid
CSB-CL004435HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 384 Sequence: atgggtttccggaagttctcccccttcctggctctcagtatcttggtcctgtaccaggcgggcagcctccaggcggcgccattcaggtctgccctggagagcagcccagacccggccacactcagtaaagaggacgcgcgcctcctgctggctgcactggtgcaggactatgtgca Show more
Description: A cloning plasmid for the CALCB gene.

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

CALCB ORF Vector (Human) (pORF)
ORF001817	ABM	1.0 ug DNA	EUR 95

CALCB ELISA Kit (Human) (OKEH00650)
OKEH00650	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Rabbit anti-LukA pAb
0316-001	IBT Bioservices	100ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-LukB pAb
0317-001	IBT Bioservices	100ug	EUR 354
Description: Related to: Staphylococcus Applications: ELISA, WB

Rabbit anti-Junin pAb
04-0006	IBT Bioservices	500ug	EUR 257
Description: Related to: Other Viruses Applications: ELISA, WB

Rabbit anti-Hla pAb
04-0010	IBT Bioservices	500ug	EUR 303
Description: Related to: Staphylococcus Applications: ELISA, WB

pAb rabbit anti-human IFN-γ
CT217	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-human IFN-γ
CT219	U-CyTech	0.5 mg	EUR 443

pAb rabbit anti-human IL-13
CT226	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-human IL-2
CT261	U-CyTech	0.5 mg	EUR 260

pAb rabbit anti-human IL-10
CT267	U-CyTech	0.5 mg	EUR 184

pAb rabbit anti-human IL-12p70
CT273	U-CyTech	0.5 mg	EUR 207

pAb rabbit anti-human G-CSF
CT278	U-CyTech	0.5 mg	EUR 184

Rat CALCB shRNA Plasmid
20-abx987792	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CALCB Polyclonal Conjugated Antibody
C31440	SAB	100ul	EUR 397

CALCB Recombinant Protein (Rat)
RP192896	ABM	100 ug	Ask for price

CALCB Recombinant Protein (Mouse)
RP120800	ABM	100 ug	Ask for price

CALCB sgRNA CRISPR Lentivector set (Human)
K0354401	ABM	3 x 1.0 ug	EUR 339

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit
E04C1315-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit
E04C1315-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit
E04C1315-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti-HCV NS5b rabbit pAb
266-A-01mg	Virogen	0,1 mg	EUR 267.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5b rabbit pAb
266-A-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5a rabbit pAb
199-A-01mg	Virogen	0,1 mg	EUR 267.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

anti-HCV NS5a rabbit pAb
199-A-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

Rabbit anti-EBOV VP40 pAb
0301-010	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV NP pAb
0301-012	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV GP pAb
0301-015	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP35 pAb
0301-040	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb
0301-046	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb
0301-047	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-EBOV VP30 pAb
0301-048	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-SUDV VP40 pAb
0302-001	IBT Bioservices	100ug	EUR 481
Description: Related to: Filoviruses Applications: ELISA, WB

Rabbit anti-human CALCB PaB