Rabbit anti-human CALCB PaB 

Order now: dominika@ksiazkiwnauce.pl

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-CALCB antibody

STJ110404 100 µl
EUR 277

CALCB siRNA

20-abx910139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALCB siRNA

20-abx910140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALCB Antibody

1-CSB-PA004435ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CALCB. Recognizes CALCB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human CALCB ELISA Kit

ELA-E0876h 96 Tests
EUR 824

CALCB ELISA KIT|Human

EF003933 96 Tests
EUR 689

Human CALCB shRNA Plasmid

20-abx950559
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCB Recombinant Protein (Human)

RP005449 100 ug Ask for price

pAb rabbit anti-human EPO

CT282 0.5 mg
EUR 184

CALCB cloning plasmid

CSB-CL004435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgggtttccggaagttctcccccttcctggctctcagtatcttggtcctgtaccaggcgggcagcctccaggcggcgccattcaggtctgccctggagagcagcccagacccggccacactcagtaaagaggacgcgcgcctcctgctggctgcactggtgcaggactatgtgca
  • Show more
Description: A cloning plasmid for the CALCB gene.

CALCA/CALCB antibody

31944-100ul 100ul
EUR 252

CALCA/CALCB antibody

31944-50ul 50ul
EUR 187

CALCB Polyclonal Antibody

31440-100ul 100ul
EUR 252

CALCB Polyclonal Antibody

31440-50ul 50ul
EUR 187

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

CALCB ORF Vector (Human) (pORF)

ORF001817 1.0 ug DNA
EUR 95

CALCB ELISA Kit (Human) (OKEH00650)

OKEH00650 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Rabbit anti-LukA pAb

0316-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-LukB pAb

0317-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-Junin pAb

04-0006 500ug
EUR 257
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-Hla pAb

04-0010 500ug
EUR 303
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

pAb rabbit anti-human IFN-γ

CT217 0.5 mg
EUR 184

pAb rabbit anti-human IFN-γ

CT219 0.5 mg
EUR 443

pAb rabbit anti-human IL-13

CT226 0.5 mg
EUR 184

pAb rabbit anti-human IL-2

CT261 0.5 mg
EUR 260

pAb rabbit anti-human IL-10

CT267 0.5 mg
EUR 184

pAb rabbit anti-human IL-12p70

CT273 0.5 mg
EUR 207

pAb rabbit anti-human G-CSF

CT278 0.5 mg
EUR 184

CALCB Polyclonal Conjugated Antibody

C31440 100ul
EUR 397

Rat CALCB shRNA Plasmid

20-abx987792
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCB Recombinant Protein (Rat)

RP192896 100 ug Ask for price

CALCB Recombinant Protein (Mouse)

RP120800 100 ug Ask for price

CALCB sgRNA CRISPR Lentivector set (Human)

K0354401 3 x 1.0 ug
EUR 339

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit

E04C1315-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit

E04C1315-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit

E04C1315-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit anti DDDDK-Tag pAb

AE004 50 ul
EUR 195

Rabbit anti GST-Tag pAb

AE006 100 ul
EUR 195

Rabbit anti GFP-Tag pAb

AE011 50 ul
EUR 176

Rabbit anti V5-Tag pAb

AE022 50 ul
EUR 256

Rabbit anti HA-Tag pAb

AE036 100 ul
EUR 308

Rabbit anti His-Tag pAb

AE068 50 ul
EUR 195

anti-HCV NS5a rabbit pAb

199-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

anti-HCV NS5a rabbit pAb

199-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

Rabbit anti-EBOV VP40 pAb

0301-010 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV NP pAb

0301-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV GP pAb

0301-015 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP35 pAb

0301-040 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-human CALCB PaB