Rabbit anti-human CALCB PaB 

Order now: dominika@ksiazkiwnauce.pl

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-CALCB antibody

STJ110404 100 µl
EUR 277

CALCB Antibody

1-CSB-PA004435ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CALCB. Recognizes CALCB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CALCB siRNA

20-abx910139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALCB siRNA

20-abx910140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human CALCB ELISA Kit

ELA-E0876h 96 Tests
EUR 824

CALCB ELISA KIT|Human

EF003933 96 Tests
EUR 689

Human CALCB shRNA Plasmid

20-abx950559
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCB Recombinant Protein (Human)

RP005449 100 ug Ask for price

pAb rabbit anti-human EPO

CT282 0.5 mg
EUR 184

CALCB Polyclonal Antibody

31440-100ul 100ul
EUR 252

CALCB Polyclonal Antibody

31440-50ul 50ul
EUR 187

CALCA/CALCB antibody

31944-100ul 100ul
EUR 252

CALCA/CALCB antibody

31944-50ul 50ul
EUR 187

CALCB cloning plasmid

CSB-CL004435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgggtttccggaagttctcccccttcctggctctcagtatcttggtcctgtaccaggcgggcagcctccaggcggcgccattcaggtctgccctggagagcagcccagacccggccacactcagtaaagaggacgcgcgcctcctgctggctgcactggtgcaggactatgtgca
  • Show more
Description: A cloning plasmid for the CALCB gene.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

CALCB ORF Vector (Human) (pORF)

ORF001817 1.0 ug DNA
EUR 95

CALCB ELISA Kit (Human) (OKEH00650)

OKEH00650 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Rabbit anti-LukA pAb

0316-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-LukB pAb

0317-001 100ug
EUR 354
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

Rabbit anti-Junin pAb

04-0006 500ug
EUR 257
Description:
  • Related to: Other Viruses
  • Applications: ELISA, WB

Rabbit anti-Hla pAb

04-0010 500ug
EUR 303
Description:
  • Related to: Staphylococcus
  • Applications: ELISA, WB

pAb rabbit anti-human IFN-γ

CT217 0.5 mg
EUR 184

pAb rabbit anti-human IFN-γ

CT219 0.5 mg
EUR 443

pAb rabbit anti-human IL-13

CT226 0.5 mg
EUR 184

pAb rabbit anti-human IL-2

CT261 0.5 mg
EUR 260

pAb rabbit anti-human IL-10

CT267 0.5 mg
EUR 184

pAb rabbit anti-human IL-12p70

CT273 0.5 mg
EUR 207

pAb rabbit anti-human G-CSF

CT278 0.5 mg
EUR 184

Rat CALCB shRNA Plasmid

20-abx987792
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCB Polyclonal Conjugated Antibody

C31440 100ul
EUR 397

CALCB Recombinant Protein (Rat)

RP192896 100 ug Ask for price

CALCB Recombinant Protein (Mouse)

RP120800 100 ug Ask for price

CALCB sgRNA CRISPR Lentivector set (Human)

K0354401 3 x 1.0 ug
EUR 339

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit

E04C1315-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit

E04C1315-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit

E04C1315-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti-HCV NS5b rabbit pAb

266-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5b rabbit pAb

266-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5b rabbit (polycnonal)Produced against a recombinant protein

anti-HCV NS5a rabbit pAb

199-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

anti-HCV NS5a rabbit pAb

199-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Viral antibodies, rAb
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein

Rabbit anti-EBOV VP40 pAb

0301-010 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV NP pAb

0301-012 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV GP pAb

0301-015 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP35 pAb

0301-040 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb

0301-046 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP24 pAb

0301-047 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-EBOV VP30 pAb

0301-048 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-SUDV VP40 pAb

0302-001 100ug
EUR 481
Description:
  • Related to: Filoviruses
  • Applications: ELISA, WB

Rabbit anti-human CALCB PaB