Rabbit anti-human CALCB PaB
Order now: dominika@ksiazkiwnauce.pl
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
CALCB siRNA |
20-abx910139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALCB siRNA |
20-abx910140 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALCB Antibody |
1-CSB-PA004435ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CALCB. Recognizes CALCB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Human CALCB shRNA Plasmid |
20-abx950559 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CALCB Recombinant Protein (Human) |
RP005449 |
ABM |
100 ug |
Ask for price |
pAb rabbit anti-human EPO |
CT282 |
U-CyTech |
0.5 mg |
EUR 184 |
CALCB cloning plasmid |
CSB-CL004435HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 384
- Sequence: atgggtttccggaagttctcccccttcctggctctcagtatcttggtcctgtaccaggcgggcagcctccaggcggcgccattcaggtctgccctggagagcagcccagacccggccacactcagtaaagaggacgcgcgcctcctgctggctgcactggtgcaggactatgtgca
- Show more
|
Description: A cloning plasmid for the CALCB gene. |
CALCA/CALCB antibody |
31944-100ul |
SAB |
100ul |
EUR 252 |
CALCA/CALCB antibody |
31944-50ul |
SAB |
50ul |
EUR 187 |
CALCB Polyclonal Antibody |
31440-100ul |
SAB |
100ul |
EUR 252 |
CALCB Polyclonal Antibody |
31440-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
CALCB ORF Vector (Human) (pORF) |
ORF001817 |
ABM |
1.0 ug DNA |
EUR 95 |
CALCB ELISA Kit (Human) (OKEH00650) |
OKEH00650 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL |
Rabbit anti-LukA pAb |
0316-001 |
IBT Bioservices |
100ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
Rabbit anti-LukB pAb |
0317-001 |
IBT Bioservices |
100ug |
EUR 354 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
Rabbit anti-Junin pAb |
04-0006 |
IBT Bioservices |
500ug |
EUR 257 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
Rabbit anti-Hla pAb |
04-0010 |
IBT Bioservices |
500ug |
EUR 303 |
Description: - Related to: Staphylococcus
- Applications: ELISA, WB
|
pAb rabbit anti-human IFN-γ |
CT217 |
U-CyTech |
0.5 mg |
EUR 184 |
pAb rabbit anti-human IFN-γ |
CT219 |
U-CyTech |
0.5 mg |
EUR 443 |
pAb rabbit anti-human IL-13 |
CT226 |
U-CyTech |
0.5 mg |
EUR 184 |
pAb rabbit anti-human IL-2 |
CT261 |
U-CyTech |
0.5 mg |
EUR 260 |
pAb rabbit anti-human IL-10 |
CT267 |
U-CyTech |
0.5 mg |
EUR 184 |
pAb rabbit anti-human IL-12p70 |
CT273 |
U-CyTech |
0.5 mg |
EUR 207 |
pAb rabbit anti-human G-CSF |
CT278 |
U-CyTech |
0.5 mg |
EUR 184 |
CALCB Polyclonal Conjugated Antibody |
C31440 |
SAB |
100ul |
EUR 397 |
Rat CALCB shRNA Plasmid |
20-abx987792 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CALCB Recombinant Protein (Rat) |
RP192896 |
ABM |
100 ug |
Ask for price |
CALCB Recombinant Protein (Mouse) |
RP120800 |
ABM |
100 ug |
Ask for price |
CALCB sgRNA CRISPR Lentivector set (Human) |
K0354401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit |
E04C1315-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit |
E04C1315-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcitonin gene related peptide 2(CALCB) ELISA kit |
E04C1315-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcitonin gene related peptide 2(CALCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit anti DDDDK-Tag pAb |
AE004 |
Abclonal |
50 ul |
EUR 195 |
Rabbit anti GST-Tag pAb |
AE006 |
Abclonal |
100 ul |
EUR 195 |
Rabbit anti GFP-Tag pAb |
AE011 |
Abclonal |
50 ul |
EUR 176 |
Rabbit anti V5-Tag pAb |
AE022 |
Abclonal |
50 ul |
EUR 256 |
Rabbit anti HA-Tag pAb |
AE036 |
Abclonal |
100 ul |
EUR 308 |
Rabbit anti His-Tag pAb |
AE068 |
Abclonal |
50 ul |
EUR 195 |
anti-HCV NS5a rabbit pAb |
199-A-01mg |
Virogen |
0,1 mg |
EUR 267.5 |
- Category: Antibody, Viral antibodies, rAb
|
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein |
anti-HCV NS5a rabbit pAb |
199-A-1000ug |
Virogen |
1000 ug |
EUR 1282.5 |
- Category: Antibody, Viral antibodies, rAb
|
Description: anti-HCV NS5a rabbit (polycnonal) Produced against a recombinant protein |
Rabbit anti-EBOV VP40 pAb |
0301-010 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
Rabbit anti-EBOV NP pAb |
0301-012 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
Rabbit anti-EBOV GP pAb |
0301-015 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
Rabbit anti-EBOV VP35 pAb |
0301-040 |
IBT Bioservices |
100ug |
EUR 481 |
Description: - Related to: Filoviruses
- Applications: ELISA, WB
|
Rabbit anti-human CALCB PaB