Goat anti CHRNA7 antibody 

Order now: dominika@ksiazkiwnauce.pl

Anti-CHRNA7 antibody

PAab01679 100 ug
EUR 355

Anti-CHRNA7 antibody

STJ111098 100 µl
EUR 277
Description: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants.

Anti-CHRNA7 antibody

STJ73312 100 µg
EUR 359

Polyclonal Goat Anti-CHRNA7 Antibody (internal region)

APG00944G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CHRNA7 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

DLR-CHRNa7-Hu-48T 48T
EUR 517
  • Should the Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

DLR-CHRNa7-Hu-96T 96T
EUR 673
  • Should the Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RDR-CHRNa7-Hu-48Tests 48 Tests
EUR 544

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RDR-CHRNa7-Hu-96Tests 96 Tests
EUR 756

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RD-CHRNa7-Hu-48Tests 48 Tests
EUR 521

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RD-CHRNa7-Hu-96Tests 96 Tests
EUR 723

Anti-CHRFAM7A / CHRNA7-FAM7A antibody

STJ71540 100 µg
EUR 260

CHRNA7 antibody

20R-1323 100 ug
EUR 377
Description: Rabbit polyclonal CHRNA7 antibody

CHRNA7 antibody

70R-1540 100 ug
EUR 377
Description: Rabbit polyclonal CHRNA7 antibody raised against the middle region of CHRNA7

CHRNA7 Antibody

48396-100ul 100ul
EUR 333

CHRNA7 Antibody

48396-50ul 50ul
EUR 239

CHRNA7 Antibody

1-CSB-PA969473
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CHRNA7. Recognizes CHRNA7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

CHRNA7 antibody

70R-49552 100 ul
EUR 244
Description: Purified Polyclonal CHRNA7 antibody

CHRNA7 Conjugated Antibody

C48396 100ul
EUR 397

CHRNA7 siRNA

20-abx901060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRNA7 siRNA

20-abx911786
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRNA7 siRNA

20-abx911787
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CHRNA7 Rabbit pAb

A1588-100ul 100 ul
EUR 308

CHRNA7 Rabbit pAb

A1588-200ul 200 ul
EUR 459

CHRNA7 Rabbit pAb

A1588-20ul 20 ul
EUR 183

CHRNA7 Rabbit pAb

A1588-50ul 50 ul
EUR 223

CHRNA7 Blocking Peptide

33R-9739 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA7 antibody, catalog no. 70R-1540

CHRNA7 Blocking Peptide

33R-7558 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA7 antibody, catalog no. 20R-1323

CHRNA7 Blocking Peptide

20-abx062427
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHRNA7 cloning plasmid

CSB-CL005393HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 966
  • Sequence: atgcaggaggcagatatcagtggctatatccccaatggagaatgggacctagtgggaatccccggcaagaggagtgaaaggttctatgagtgctgcaaagagccctaccccgatgtcaccttcacagtgaccatgcgccgcaggacgctctactatggcctcaacctgctgatccc
  • Show more
Description: A cloning plasmid for the CHRNA7 gene.

pcDNA3.1(+)-CHRNA7 Plasmid

PVTB00095-2a 2 ug
EUR 356

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

DLR-GOAT-Hu-48T 48T
EUR 554
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

DLR-GOAT-Hu-96T 96T
EUR 725
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-48Tests 48 Tests
EUR 589

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-96Tests 96 Tests
EUR 820

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RD-GOAT-Hu-48Tests 48 Tests
EUR 563

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RD-GOAT-Hu-96Tests 96 Tests
EUR 783

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx006553
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx111623
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx123005
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx141429
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal CHRNA7 antibody - N-terminal region

APG02588G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHRNA7 - N-terminal region. This antibody is tested and proven to work in the following applications:

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx340150-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx340151-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx320604
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx322747
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx430847-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx231673-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Chicken CHRNA7 ELISA KIT

ELI-24651c 96 Tests
EUR 928

CHRNA7 ELISA KIT|Human

EF008659 96 Tests
EUR 689

Rat CHRNA7 shRNA Plasmid

20-abx984906
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CHRNA7 shRNA Plasmid

20-abx969004
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CHRNA7 shRNA Plasmid

20-abx950816
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-CHRNA7 Plasmid

PVT16678 2 ug
EUR 325

pCMV-SPORT6-CHRNA7 Plasmid

PVTB00095S 2 ug
EUR 356

CHRNA7 Recombinant Protein (Human)

RP007072 100 ug Ask for price

CHRNA7 Recombinant Protein (Rat)

RP194957 100 ug Ask for price

CHRNA7 Recombinant Protein (Mouse)

RP124076 100 ug Ask for price

Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) Antibody

20-abx128073
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) Antibody

20-abx171730
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNA7) Antibody

20-abx241957
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal CHRFAM7A / CHRNA7-FAM7A Antibody (N-Term)

APG02574G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHRFAM7A / CHRNA7-FAM7A (N-Term). This antibody is tested and proven to work in the following applications:

Anti-Goat IgG antibody

STJ16101225 1 mg
EUR 191

Goat anti CHRNA7 antibody