Goat anti CHRNA7 antibody
Order now: dominika@ksiazkiwnauce.pl
Anti-CHRNA7 antibody |
STJ111098 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. |
Polyclonal Goat Anti-CHRNA7 Antibody (internal region) |
APG00944G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CHRNA7 (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit |
DLR-CHRNa7-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit |
DLR-CHRNa7-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit |
RD-CHRNa7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit |
RD-CHRNa7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit |
RDR-CHRNa7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit |
RDR-CHRNa7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
CHRNA7 antibody |
70R-49552 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CHRNA7 antibody |
CHRNA7 Antibody |
48396-100ul |
SAB |
100ul |
EUR 333 |
CHRNA7 Antibody |
48396-50ul |
SAB |
50ul |
EUR 239 |
CHRNA7 antibody |
20R-1323 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal CHRNA7 antibody |
CHRNA7 antibody |
70R-1540 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal CHRNA7 antibody raised against the middle region of CHRNA7 |
CHRNA7 Antibody |
1-CSB-PA969473 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CHRNA7. Recognizes CHRNA7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
CHRNA7 Conjugated Antibody |
C48396 |
SAB |
100ul |
EUR 397 |
CHRNA7 siRNA |
20-abx901060 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHRNA7 siRNA |
20-abx911786 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHRNA7 siRNA |
20-abx911787 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit |
E06C1702-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit |
E06C1702-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit |
E06C1702-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CHRNA7 cloning plasmid |
CSB-CL005393HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 966
- Sequence: atgcaggaggcagatatcagtggctatatccccaatggagaatgggacctagtgggaatccccggcaagaggagtgaaaggttctatgagtgctgcaaagagccctaccccgatgtcaccttcacagtgaccatgcgccgcaggacgctctactatggcctcaacctgctgatccc
- Show more
|
Description: A cloning plasmid for the CHRNA7 gene. |
CHRNA7 Blocking Peptide |
20-abx062427 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHRNA7 Rabbit pAb |
A1588-100ul |
Abclonal |
100 ul |
EUR 308 |
CHRNA7 Rabbit pAb |
A1588-200ul |
Abclonal |
200 ul |
EUR 459 |
CHRNA7 Rabbit pAb |
A1588-20ul |
Abclonal |
20 ul |
EUR 183 |
CHRNA7 Rabbit pAb |
A1588-50ul |
Abclonal |
50 ul |
EUR 223 |
CHRNA7 Blocking Peptide |
33R-7558 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA7 antibody, catalog no. 20R-1323 |
CHRNA7 Blocking Peptide |
33R-9739 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA7 antibody, catalog no. 70R-1540 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
DLR-GOAT-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
DLR-GOAT-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RD-GOAT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RD-GOAT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RDR-GOAT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RDR-GOAT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Polyclonal CHRNA7 antibody - N-terminal region |
APG02588G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHRNA7 - N-terminal region. This antibody is tested and proven to work in the following applications: |
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
20-abx111623 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
20-abx123005 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
20-abx141429 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
20-abx006553 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
20-abx320604 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
20-abx322747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
abx340150-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
abx340151-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
abx430847-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody |
abx231673-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rat CHRNA7 shRNA Plasmid |
20-abx984906 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CHRNA7 shRNA Plasmid |
20-abx950816 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CHRNA7 shRNA Plasmid |
20-abx969004 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CHRNA7 Recombinant Protein (Human) |
RP007072 |
ABM |
100 ug |
Ask for price |
CHRNA7 Recombinant Protein (Rat) |
RP194957 |
ABM |
100 ug |
Ask for price |
CHRNA7 Recombinant Protein (Mouse) |
RP124076 |
ABM |
100 ug |
Ask for price |
Polyclonal CHRFAM7A / CHRNA7-FAM7A Antibody (N-Term) |
APG02574G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHRFAM7A / CHRNA7-FAM7A (N-Term). This antibody is tested and proven to work in the following applications: |
Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) Antibody |
20-abx128073 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNA7) Antibody |
20-abx241957 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) Antibody |
20-abx171730 |
Abbexa |
|
|
|
Goat anti CHRNA7 antibody