Goat anti CHRNA7 antibody 

Order now: dominika@ksiazkiwnauce.pl

Anti-CHRNA7 antibody

PAab01679 100 ug
EUR 355

Anti-CHRNA7 antibody

STJ73312 100 µg
EUR 359

Anti-CHRNA7 antibody

STJ111098 100 µl
EUR 277
Description: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants.

Polyclonal Goat Anti-CHRNA7 Antibody (internal region)

APG00944G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CHRNA7 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

DLR-CHRNa7-Hu-48T 48T
EUR 517
  • Should the Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

DLR-CHRNa7-Hu-96T 96T
EUR 673
  • Should the Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RD-CHRNa7-Hu-48Tests 48 Tests
EUR 521

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RD-CHRNa7-Hu-96Tests 96 Tests
EUR 723

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RDR-CHRNa7-Hu-48Tests 48 Tests
EUR 544

Human Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) ELISA Kit

RDR-CHRNa7-Hu-96Tests 96 Tests
EUR 756

Anti-CHRFAM7A / CHRNA7-FAM7A antibody

STJ71540 100 µg
EUR 260

CHRNA7 antibody

70R-49552 100 ul
EUR 244
Description: Purified Polyclonal CHRNA7 antibody

CHRNA7 Antibody

48396-100ul 100ul
EUR 333

CHRNA7 Antibody

48396-50ul 50ul
EUR 239

CHRNA7 antibody

20R-1323 100 ug
EUR 377
Description: Rabbit polyclonal CHRNA7 antibody

CHRNA7 antibody

70R-1540 100 ug
EUR 377
Description: Rabbit polyclonal CHRNA7 antibody raised against the middle region of CHRNA7

CHRNA7 Antibody

1-CSB-PA969473
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CHRNA7. Recognizes CHRNA7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

CHRNA7 Conjugated Antibody

C48396 100ul
EUR 397

CHRNA7 siRNA

20-abx901060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRNA7 siRNA

20-abx911786
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRNA7 siRNA

20-abx911787
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CHRNA7 cloning plasmid

CSB-CL005393HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 966
  • Sequence: atgcaggaggcagatatcagtggctatatccccaatggagaatgggacctagtgggaatccccggcaagaggagtgaaaggttctatgagtgctgcaaagagccctaccccgatgtcaccttcacagtgaccatgcgccgcaggacgctctactatggcctcaacctgctgatccc
  • Show more
Description: A cloning plasmid for the CHRNA7 gene.

CHRNA7 Blocking Peptide

20-abx062427
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHRNA7 Rabbit pAb

A1588-100ul 100 ul
EUR 308

CHRNA7 Rabbit pAb

A1588-200ul 200 ul
EUR 459

CHRNA7 Rabbit pAb

A1588-20ul 20 ul
EUR 183

CHRNA7 Rabbit pAb

A1588-50ul 50 ul
EUR 223

CHRNA7 Blocking Peptide

33R-7558 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA7 antibody, catalog no. 20R-1323

CHRNA7 Blocking Peptide

33R-9739 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHRNA7 antibody, catalog no. 70R-1540

pcDNA3.1(+)-CHRNA7 Plasmid

PVTB00095-2a 2 ug
EUR 356

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

DLR-GOAT-Hu-48T 48T
EUR 554
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

DLR-GOAT-Hu-96T 96T
EUR 725
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RD-GOAT-Hu-48Tests 48 Tests
EUR 563

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RD-GOAT-Hu-96Tests 96 Tests
EUR 783

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-48Tests 48 Tests
EUR 589

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-96Tests 96 Tests
EUR 820

Polyclonal CHRNA7 antibody - N-terminal region

APG02588G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHRNA7 - N-terminal region. This antibody is tested and proven to work in the following applications:

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx111623
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx123005
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx141429
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx006553
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx320604
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

20-abx322747
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx340150-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx340151-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx430847-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

CHRNA7-FAM7A Fusion Protein (CHRFAM7A) Antibody

abx231673-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rat CHRNA7 shRNA Plasmid

20-abx984906
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken CHRNA7 ELISA KIT

ELI-24651c 96 Tests
EUR 928

CHRNA7 ELISA KIT|Human

EF008659 96 Tests
EUR 689

Human CHRNA7 shRNA Plasmid

20-abx950816
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CHRNA7 shRNA Plasmid

20-abx969004
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CHRNA7 Recombinant Protein (Human)

RP007072 100 ug Ask for price

pCMV-SPORT6-CHRNA7 Plasmid

PVTB00095S 2 ug
EUR 356

pCMV-SPORT6-CHRNA7 Plasmid

PVT16678 2 ug
EUR 325

CHRNA7 Recombinant Protein (Rat)

RP194957 100 ug Ask for price

CHRNA7 Recombinant Protein (Mouse)

RP124076 100 ug Ask for price

Polyclonal CHRFAM7A / CHRNA7-FAM7A Antibody (N-Term)

APG02574G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CHRFAM7A / CHRNA7-FAM7A (N-Term). This antibody is tested and proven to work in the following applications:

Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) Antibody

20-abx128073
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNA7) Antibody

20-abx241957
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholinergic Receptor, Nicotinic, Alpha 7 (CHRNa7) Antibody

20-abx171730
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-Goat IgG antibody

STJ16101225 1 mg
EUR 191

Goat anti CHRNA7 antibody